drizzyizzydem816 drizzyizzydem816

15-11-2019
Physics

contestada

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

Respuesta :

15-11-2019

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

Answer Link

Otras preguntas

how much does 400 go into 10

The square of a whole number 'n' lies between 80 and 150. Find all possible values for 'n'.

Specific gravity is the density of an object compared to water? true or false?

what does R.A.F.T mean

how to multiply 396×37

What would Shakespeare have meant in using the word prevent?

explain why is it important to line up decimals numbers by their place value when you add or subtract them

Write a paragraph explaining how domesticating livestock allowed civilizations to spread.

what is one fifth of 25

The 3 parts of a nucleotide are a 5 carbon __________, a phosphate, and a nitrogen ___________.