shiyonapizzagir shiyonapizzagir

04-04-2018
Mathematics

contestada

if a= 3+√5/2 then find the value of a2 + 1/a2

Respuesta :

jmthielen1108 jmthielen1108

04-04-2018

3979 + 990√10
338

or 21.03448190

Answer Link

Аноним Аноним

06-09-2021

Please find attached photograph for your answer.

Ver imagen Аноним

Answer Link

Otras preguntas

Which postulate could we use to prove that the angles

Which is beter 4G network or 5G network? What's the difference between them?

Select all that apply Which conditions are necessary for the diffusion of a substance to occur across a membrane? a concentration gradient a supply of energy me

A shirt costs ₹(a2 –ab -b2 ) , a pair of trousers cost ₹(2a2 +8ab-2b2 ) and a pair of shoes cost ₹(a2 –3ab+4b2 ) .After collecting these three items from the st

Water boils at different temperatures at different elevations. The boiling temperature of water is 212F at sea level (0 feet) but drops about 1.72F for every

Características físicas de el medio oeste (5)

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

why scientists think the hoodoos will disappear someday.

Select the correct answer from each drop-down menu. The United Nations promotes in an effort to maintain world peace and protect future generations. The toxic i

Select the correct answer from each drop-down menu. The United Nations promotes in an effort to maintain world peace and protect future generations. The toxic i